Duplex Predictor

This tool predicts the most probable miRNA duplex on a given miRNA hairpin. 
You can  upload a  txt  file with  your sequences in fasta format, (include fasta file header). 
Output is a three columns tab delimited table. The first column specifies the sequences
IDs as they were specified by the user, the second and the third columns shows the most 
probable matures from the 5' and the 3' strand of the hairpin respectively.  Entries for 
which the RNAfold output is not a hairpin or consists of multiple stems are filtered out
and 'Multibranch - No prediction' is returned as an output at the respective line. 
An e-mail could be provided in order to receive your results.

Thank you for using MiRduplexSVM.

 Input example: 
>MI0000060
UGGGAUGAGGUAGUAGGUUGUAUAGUUUUAGGGUCACACCCACCACUGGGAGAUAACUAUACAAUCUACUGUCUUUCCUA
>MI0000061
AGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCU
>MI0000065
CCUAGGAAGAGGUAGUAGGUUGCAUAGUUUUAGGGCAGGGAUUUUGCCCACAAGGAGGUAACUAUACGACCUGCUGCCUUUCUUAGG
>MI0003603
UCUUAUCAAUGAGGUAGACCAUGGGUUCUCAUUGUAAUAGUGUAGAAUGUUGGUUAACUGUGGACUCCCUGGCUCUGUCUCAAAUCUACUGAUUC
>MI0000070
GUCAGCAGUGCCUUAGCAGCACGUAAAUAUUGGCGUUAAGAUUCUAAAAUUAUCUCCAGUAUUAACUGUGCUGCUGAAGUAAGGUUGAC
>MI0003681
GUGUAGUAGAGCUAGGAGGAGAGGGUCCUGGAGAAGCGUGGACCGGUCCGGGUGGGUUCCGGCAGGUUCUCACCCUCUCUAGGCCCCAUUCUCCUCUG
>MI0000071
GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGAAGGCACUUGUAGCAUUAUGGUGAC


Output example:
MI0000060 UGAGGUAGUAGGUUGUAUAGUU CUAUACAAUCUACUGUCUUUC
MI0000061 UGAGGUAGUAGGUUGUAUAGUU CUGUACAGCCUCCUAGCUUUCC
MI0000065 AGAGGUAGUAGGUUGCAUAGUU CUAUACGACCUGCUGCCUUUC
MI0003603 Multibranch ­ No prediction
MI0000070 UAGCAGCACGUAAAUAUUGGCG CCAGUAUUAACUGUGCUGCUGA
MI0003681 Multibranch ­ No prediction
MI0000071 CAAAGUGCUUACAGUGCAGGUAG ACUGCAGUGAAGGCACUUGUAG


Upload FASTA data (include fasta file header):


Paste FASTA data (include fasta file header):

Email to receive results (optional):


MiRduplexSVM takes 10-30 minutes to complete. You will receive the results in the email address you specified above.